Covid-19 – Evidence of global fraud (II)
Covid-19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud.
Read the first part of the article
Testing for nothing
The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official covid-19 narrative, assert that SARS-CoV-2 causes covid-19.
While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.
Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to “identify” the presence of the “virus”. These include:
– RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of covid-19 diseased epithelial cells.
– S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
– E gene (Orf1ab) – small membrane protein used in viral assembly.
– N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation.
The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)
The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers. It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.
Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore anyone can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.
The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what is found.
The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If is run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 “isolate” with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also “identifies” SARS-CoV-2.
However, BLAST also enables to search the nucleotide sequences of the microbial and human genomes. If is searched for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.
Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.
Whenever is checked the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, it is found complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.
So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome.
Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this: “Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and perverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.”
This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.
Moroccan researchers investigated the epidemiology of Moroccan alleged “cases” of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As it was just discussed, many may have been positive for none.
This is entirely in keeping with WHO’s test guidelines. They state: “An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used… One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”
Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.
The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all people know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.
RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)
For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.
No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.
If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called covid-19 exists.
This infers that there is no scientific basis for any claims about covid-19 case numbers, hospital admissions or mortality figures. All measures taken to “combat” this “deadly virus” are quite possibly founded upon nothing.
Conclusive fraud
Fraud is a criminal act. The legal definition of fraud is: “Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”
The Legal definition of a conspiracy is: “A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act.”
It seems, those who claim people face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.
For there to be a fraud the deceit must be willful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organizations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.
It seems covid-19 has been deliberately used as a casus belli to wage war on humanity. People have been imprisoned in their own homes, their freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, their businesses destroyed, psychologically bombarded, muzzled and terrorised.
Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services people pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.
Further, it is proposed by those who have forwarded the covid-19 story, that this alleged disease provides justification for the complete restructuring of the global economy, the political systems, societies, cultures and humanity itself. To be allowed to participate in their so called “new normal,” which is the wholesale transformation of the entire society without people’s consent, they insist people submit to their conditions.
These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of people transactions, oppressive business and social restrictions and an effective demand that people have no right to sovereignty over their own bodies. This constitutes the condition of slavery.
There is no doubt that people have been deprived of their rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.
In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocence they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting covid-19 is a myth.
Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of the people get on with trying to repair the damage they have already inflicted.
yogaesoteric
April 17, 2021